site stats

Maltoporin

WebMar 21, 1997 · Maltoporin (LamB) facilitates the diffusion of maltodextrins across the outer membrane of E. coli. The structural basis for the specificity of the channel is investigated by X-ray structure analysis of maltoporin in complex with the disaccharides sucrose, trehalose, and melibiose. The sucrose complex, determined to 2.4 A resolution, shows that ... WebWe have determined the sequence of the lamB gene from Klebsiella pneumoniae. It encodes the precursor to the LamB protein, a 429 amino acid polypeptide with maltoporin function. Comparison with the Escherichia coli LamB protein reveals a high degree of homology, with 325 residues strictly identical. The N-terminal third of the protein is the …

Identification and characterization of a novel ... - ScienceDirect

WebA polypeptide hormone secreted by the intermediate lobe of the hypophysis in humans (in neurohypophysis in certain other species), that causes dispersion of melanin by … WebMaltoporin Details Name Maltoporin Synonyms Lambda receptor protein malB Maltose-inducible porin Gene Name lamB Organism Escherichia coli (strain K12) Amino acid … gray diamond rug https://ptforthemind.com

Translocation mechanism of long sugar chains across the maltoporin ...

WebOct 1, 2004 · Maltoporin: sugar for physics and biology. Maltoporin has been studied for over 50 years. This trimeric bacterial outer membrane channel allows permeation of sugars such as maltodextrins. Its structure is described and functional studies resulting in a mechanistic transport model are critically discussed. WebOct 5, 2012 · The LamB protein is a well-characterized example of a porin, termed as a maltoporin, because it is required for growth on limiting concentrations of maltose. The protein coded by gene lamB of the maltose operon also serves as receptors for several phages, such as λ, K10 and TP1 [ 48 , 49 , 50 ]. WebFeb 1, 1996 · Results The crystal structures of maltoporin in complex with maltose, maltotriose and maltohexaose reveal an extended binding site within the maltoporin channel. The maltooligosaccharides are in apolar van der Waals contact with the ‘greasy slide’, a hydrophobic path that is composed of aromatic residues and located at the … gray diamond earrings

Maltoporin - Wikipedia

Category:Structure and function of bacterial outer ... - Wiley Online Library

Tags:Maltoporin

Maltoporin

Cysteine-22 and cysteine-38 are not essential for the functions of ...

WebJan 11, 1996 · Maltoporin (which is encoded by the lamB gene) facilitates the translocation of maltodextrins across the outer membrane of E. coli. In particular, it is indispensable for … WebJan 20, 1990 · Maltoporin is an integral membrane protein, which forms a channel in the E. coli outer membrane that specifically facilitates the diffusion of maltose and …

Maltoporin

Did you know?

Webcd01346: Maltoporin-like Download alignment The Maltoporin-like channels (LamB porin) form a trimeric structure which facilitate the diffusion of maltodextrins and other sugars across the outer membrane of Gram-negative bacteria. The membrane channel is formed by an 18-strand antiparallel beta-barrel (18,22). WebMaltoporin appears to be constituted by three different domains: a major rod-like domain spanning the membrane, a minor domain located near the periplasmic surface of the …

WebNov 7, 2024 · Maltoporin (LamB) has a size of ~49 kDa. OmpC and OmpF are approximately the same size and run as a single band at ~39 kDa, and OmpA has the smallest size of ~35 kDa. All of these protein bands are visible in the parent strain. The single knock-out strain BL21ΔA shows all bands of interest except the 35 kDa OmpA … WebLocus tag: KPN_04425 Name: lamB Funciton: maltoporin Locus tag: KPN_04426 Name: malM Funciton: maltose regulon periplasmic protein malK-lamB-malM-254: 4.5: TTGTGTGATCTCCATTGCAAAA: KPN_04424-225: 3.7: TATTGCGTCCTGGAGCACAGAA: Photorhabdus luminescens subsp. laumondii TTO1 Position ...

WebFind patient medical information for menotropins injection on WebMD including its uses, side effects and safety, interactions, pictures, warnings and user ratings. WebThe sequence analyses by the IEDB server resulted in three 15-mer peptides of the core epitope, FTAEHTQSV, FLVNQTLTL, and MRAGSATVR from FepA, Maltoporin, and OmpW, respectively, as the most potential epitopes that have an affinity with both cytotoxic and helper T-cells.

WebThe maltoporin channel is asymmetric and, added from one side only, predominantly inserts in an oriented manner. The asymmetry of the channel structure manifests itself in …

WebMar 2, 2005 · One of them, maltoporin, is a passive specific channel for the maltodextrin uptake. This channel was also named LamB as the bacterial virus phage Lambda mis-uses this channel to recognise the bacteria. The first step is a reversible binding followed after a lag phase by DNA injection. chocolate\u0027s byWebNational Center for Biotechnology Information chocolate\u0027s f9WebAbstract Maltoporin allows permeation of long maltodextrin chains. It tightly binds the amphiphilic sugar, offering both hydrophobic interactions with a helical lane of aromatic residues and H bonds with ionic side chains. chocolate\u0027s fi